View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8697_low_9 (Length: 266)

Name: NF8697_low_9
Description: NF8697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8697_low_9
NF8697_low_9
[»] chr1 (1 HSPs)
chr1 (18-237)||(7432278-7432497)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 7432278 - 7432497
Alignment:
18 agtatgtgtctatgtgtcttgcgatattcttttattttatttttctatcgttcgttggtgttctaatacaatcattcgactatttagacttcgtttgacc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||    
7432278 agtatgtgtctatgtgtcttgcgatattcttttattttatttttttatcgtttgttggtgttctaatacaatcattcgactatttagacttcatttgacc 7432377  T
118 ttaattggttggtggtttattttcaactaattgtaacatatgtaatcttttttcatagctaatatttttattagatttgcttcttgttccaaattattga 217  Q
    ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||    
7432378 ttaattgattggtggtttattttcaactaagtgtaacatatgtaatcttttttcatagttaatctttttattagatttgcttcttgttccaaattattga 7432477  T
218 tccttttttctcttcttctc 237  Q
     |||||||||||||||||||    
7432478 accttttttctcttcttctc 7432497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University