View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8698_low_12 (Length: 224)

Name: NF8698_low_12
Description: NF8698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8698_low_12
NF8698_low_12
[»] chr3 (1 HSPs)
chr3 (14-81)||(52610618-52610685)
[»] chr2 (1 HSPs)
chr2 (14-67)||(23881376-23881429)
[»] chr1 (1 HSPs)
chr1 (24-81)||(31330946-31331003)


Alignment Details
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 52610685 - 52610618
Alignment:
14 cagcacagagtacaaacttttataacatatgagatttcaacatgtgtggctaatgccaataacaacat 81  Q
    ||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
52610685 cagcatagagtgcaaacttttataacagatgagatttcaacatgtgtggctaatgccaataacaacat 52610618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 14 - 67
Target Start/End: Original strand, 23881376 - 23881429
Alignment:
14 cagcacagagtacaaacttttataacatatgagatttcaacatgtgtggctaat 67  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||    
23881376 cagcatagagtacaaacttttataacagatgagatttcaacatgtgtggctaat 23881429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 81
Target Start/End: Complemental strand, 31331003 - 31330946
Alignment:
24 tacaaacttttataacatatgagatttcaacatgtgtggctaatgccaataacaacat 81  Q
    |||||| |||||||||| |||  |||||||||  ||||||||||||||||||||||||    
31331003 tacaaatttttataacagatggaatttcaacacatgtggctaatgccaataacaacat 31330946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University