View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8698_low_9 (Length: 237)
Name: NF8698_low_9
Description: NF8698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8698_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 780026 - 779809
Alignment:
| Q |
1 |
tctaggtcattagctttatagcacatacacttatgatagatgacgtctatgatgtctaacatgtgtcggacaaattaaatgtgataagttcaataaactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
780026 |
tctaggtcattagctttatagcacatacacttatgatagatgacgtctatgatgtctaacatgtgtcggacaact-----gtgataagttcaataaactc |
779932 |
T |
 |
| Q |
101 |
attcgcttattaatttttacgtgtcttaagtccgtaacggtgtttcatagatcattatcctattgactatgactctccattacaat-nnnnnnnccatga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
779931 |
attcgcttattaatttttacgtgtcttaagtccgtaacagtgtttcatagatcattatcctattgactatgactctccattacaataaaacaaaccatga |
779832 |
T |
 |
| Q |
200 |
aattaataaacaactaacattct |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
779831 |
aattaataaacaactaacattct |
779809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University