View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8700_high_1 (Length: 347)
Name: NF8700_high_1
Description: NF8700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8700_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 7722914 - 7722749
Alignment:
| Q |
18 |
agtgagtgtgtaatgtaagcaagtgtttgagtttctattatatctctgcagaattactactgtttatgacacccttcatgtatgattttgatttcttctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7722914 |
agtgagtgtgtaatgtaagcaagtgtttgagtttctattatatctctgcagaattactactgtttatgacacccttcatgtatcattttgatttcttctt |
7722815 |
T |
 |
| Q |
118 |
gcataatgcatagtttcaatttatactagtagaaagatcataaagataaagaaagagaaagagagg |
183 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722814 |
gaataatgcatagtttcaatttatactagtagaaagatcataaagataaagaaagagaaagagagg |
7722749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 204 - 338
Target Start/End: Complemental strand, 7722723 - 7722589
Alignment:
| Q |
204 |
atgatgggttggtcaaaagagcccacgtgactagagggaacggtcttcaagggatctatctatctgcaaggtttttctccgatcacgaggctttattagt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722723 |
atgatgggttggtcaaaagagcccacgtgactagagggaacggtcttcaagggatctatctatctgcaaggtttttctccgatcacgaggctttattagt |
7722624 |
T |
 |
| Q |
304 |
gtctcaaaaacctctgtccgtatccgtatctctgc |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722623 |
gtctcaaaaacctctgtccgtatccgtatctctgc |
7722589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University