View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8700_low_2 (Length: 417)
Name: NF8700_low_2
Description: NF8700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8700_low_2 |
 | |
|
| [»] scaffold0128 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0128 (Bit Score: 126; Significance: 8e-65; HSPs: 3)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 244 - 389
Target Start/End: Original strand, 21792 - 21936
Alignment:
| Q |
244 |
atattttagtatctattccaaggcttgacaaatgatagcatgtttgactgttatcagttttacaagaactggcagattgattcattcttttaacaacttt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21792 |
atattttagtatctattccaaggcttgacaaatgatagcatgttt-actgttatcagttttacaagaactggcagattcattcattcttttaacaacttt |
21890 |
T |
|
| Q |
344 |
ttataggatacaaggaagggattacaacgcaaacaacatgagtatt |
389 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21891 |
ttataggatgcaaggaatggattacaacgcaaacaacatgagtatt |
21936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 203 - 246
Target Start/End: Original strand, 6463 - 6506
Alignment:
| Q |
203 |
tgcatgatattttggtcatcttgtatttgatcacatggaaaata |
246 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6463 |
tgcatgatattttggtcatctcgtatttgatcacatggaaaata |
6506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 194
Target Start/End: Original strand, 6422 - 6474
Alignment:
| Q |
142 |
tcacatggtccactgatgtactttctttcaaagattgtgcatgcatgatattt |
194 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
6422 |
tcacatgatccattgatgtactttctttcaaagattgtacctgcatgatattt |
6474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 268 - 349
Target Start/End: Complemental strand, 22482543 - 22482462
Alignment:
| Q |
268 |
ttgacaaatgatagcatgtttgactgttatcagttttacaagaactggcagattgattcattcttttaacaactttttatag |
349 |
Q |
| |
|
||||||||| |||||| |||| ||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22482543 |
ttgacaaataatagcacaattgattgttatccgttttacaagaactagcagattcattcattcttttaacaactttttatag |
22482462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 95
Target Start/End: Complemental strand, 7300892 - 7300832
Alignment:
| Q |
35 |
gatgcatgcagttctgattaagggtcaagttactaatggatctgcaaatgttaggtaaaca |
95 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||||| ||| | ||||||| |||||||| |
|
|
| T |
7300892 |
gatgcatccagttctgatttagggtcatgttactaatgcatccgaaaatgttgggtaaaca |
7300832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University