View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8701_high_12 (Length: 310)
Name: NF8701_high_12
Description: NF8701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8701_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 155 - 295
Target Start/End: Complemental strand, 33246715 - 33246567
Alignment:
| Q |
155 |
cgatatgaatttgatgatagtccaaatttgttagcgaaaaaagcgcatcgtgggtatagtcagtcctttcactacgtgttacac--------caataaat |
246 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
33246715 |
cgatatgattttgatgatagtccaaatttgttagcgaaaaaagcgcatcgtgggtatagtcagtcctttcactacgtgttgcaccaaatcaacaataaat |
33246616 |
T |
 |
| Q |
247 |
ccaccaccattcacaacaacaacgtattttcaggaacaacaatgatgtc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246615 |
ccaccaccattcacaacaacaacgtattttcaggaacaacaatgatgtc |
33246567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University