View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8701_high_14 (Length: 273)
Name: NF8701_high_14
Description: NF8701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8701_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 49812565 - 49812795
Alignment:
| Q |
20 |
acccatgccggtgataaacacaaacaaacaacctccaaaacaaagaatatgtatgatcaatgaagaattgaattggatatgcttttatatttcaatggct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49812565 |
acccatgccggtgataaacacaaacaaacaacctccaaaacaaagaatatgtatgatcaatgaagaattgaattggatatgcttttatatttcaatggct |
49812664 |
T |
|
| Q |
120 |
taatttggttgtttattcggttgaaatagcgaatcttgtcttttttattttaaaccgaggcccatattgtaatgcattgtatatatagaaattgtttcgt |
219 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49812665 |
----------gtttattcggttgaaataacgaatcttgtcttttttattttaaaccgaggcccatattgtaatgcattgtatatatagaaattgtttcgt |
49812754 |
T |
|
| Q |
220 |
ttaattttggcatatgcgtgtgtgtgatttttgttgttcat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49812755 |
ttaattttggcatatgcgtgtgtgtgatttttgttgttcat |
49812795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University