View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8701_high_6 (Length: 449)
Name: NF8701_high_6
Description: NF8701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8701_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 413; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 10 - 442
Target Start/End: Complemental strand, 48271490 - 48271058
Alignment:
| Q |
10 |
atggacatcatagactccaaagaaatgaattgtctgctgactaaaatccttgttcattccatccttgttcattccatcatatttgctgttaccatttagc |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271490 |
atggccatcatagactccaaagaaatgaattgtctgctgactaaaatccttgttcattccatccttgttcattccatcatatttgctgttaccatttagc |
48271391 |
T |
 |
| Q |
110 |
atttgaataggaattttcaacatccgaggtgcaatcgcaacagcatcttccatctcaggtctctttccacataaagatgtaagcccccaaagtggggtac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48271390 |
atttgaataggaattttcaacatccgaggtgcaatcgcaacagcatcttccatctcaggtctctttccacataaagatgtaaacccccaaagtggggtac |
48271291 |
T |
 |
| Q |
210 |
aatccaattcaaaaacactccgaccaactgttccactcaccccttttttaagaggcagttgatgaagagcaactgtagtaggcaacggtactgatctaac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271290 |
aatccaattcaaaaacactccgaccaactgttccactcaccccttttttaagaggcagttgatgaagagcaactgtagtaggcaacggtactgatctaac |
48271191 |
T |
 |
| Q |
310 |
tcctgtttcgtctccaatgctcaatgctacagcaagaggttcactcataatatctgcctccacatttgactcgtcgataacagcagccctagcaacaatt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271190 |
tcctgtttcgtctccaatgctcaatgctacagcaagaggttcactcataatatctgtctccacatttgactcgtcgataacagcagccctagcaacaatt |
48271091 |
T |
 |
| Q |
410 |
tcgacagaggatatgttcttattgatgtccatc |
442 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
48271090 |
tcgacagaggatatgttcttatctatgtccatc |
48271058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University