View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8701_low_21 (Length: 268)
Name: NF8701_low_21
Description: NF8701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8701_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 15561070 - 15561319
Alignment:
| Q |
1 |
cgaaggctatggagagtcttaatcatctagatttcattatttataaaatttactaacacttgtaaaacatgtattgggttttgatggttggttaattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15561070 |
cgaaggctatggagagtcttaatcatctagatttcattgtttataaaatttactaacacttgtaaaacatgtattgggttttgatggttggttaattcat |
15561169 |
T |
 |
| Q |
101 |
atgatctagtcaaagattactaattggtgggattctttttggcaaattttgacggttttgaataaaatgagagttgagaatttggcaattataaactatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15561170 |
atgatctagtcaaagattactaattggtgggattctttttggcaaattttgacggttttgaataaaatgagagttgagaatttggcaattataaactatt |
15561269 |
T |
 |
| Q |
201 |
ttgtttgtatataatcagttttacacattttgggcccgaatcttcctttt |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15561270 |
ttgtttgtatataatcaaatttacacattttgggcccgaatcttcctttt |
15561319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University