View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8701_low_27 (Length: 238)
Name: NF8701_low_27
Description: NF8701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8701_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 70 - 223
Target Start/End: Complemental strand, 43450483 - 43450329
Alignment:
| Q |
70 |
tcaaatactcctaaattcaagtatattaatctagtaataataatataacctaagttaagtgaaaaa-ccatcctctctggcaaattcatgttgattgcga |
168 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43450483 |
tcaaatactcctacattcaagtatattaatctagtaataataatataacctaagttaagtgaaaaaaccatcctctctggcaaattcatgttgattgcga |
43450384 |
T |
|
| Q |
169 |
aaataattgggtagggtccctctcaaaaggtcacaaactctcgtgtggcattgat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450383 |
aaataattgggtagggtccctctcaaaaggtcacaaactctcgtgtggcattgat |
43450329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University