View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8702_low_4 (Length: 361)
Name: NF8702_low_4
Description: NF8702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8702_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 34413817 - 34413710
Alignment:
| Q |
18 |
ccaagttggtgaagattgccaattattggtagctttggtggtgaaggaggcaaattcagtttatttcttcttatcaatttaagcacaaacacaaggctag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34413817 |
ccaagttggtgaagattgccaattattggtagctttggtggtgaaggaggcaaattttgtttatttcttcttatcaatttaagcacaaacacaaggctag |
34413718 |
T |
|
| Q |
118 |
tgaagcag |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
34413717 |
tgaagcag |
34413710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University