View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8703_low_11 (Length: 273)

Name: NF8703_low_11
Description: NF8703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8703_low_11
NF8703_low_11
[»] chr4 (1 HSPs)
chr4 (1-257)||(51674079-51674341)


Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 51674079 - 51674341
Alignment:
1 cggaagcaaaaccgagagacggagcaatgaaatcgattgaattaacggaagagcattgagagattagcgtatcgaagagattttgaaacggtgacggtgg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||    
51674079 cggaagcaaaaccgagagacggagcaatgaaatcgattgaattaacggaagagcattgagagattagcgtgttgaagagattttcaaacggtgacggtgg 51674178  T
101 aggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcgggaagaaaagaggttgttagg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51674179 aggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcgggaagaaaagaggttgttagg 51674278  T
201 gttgtaaccgcc------atcatgatgatgatgaaagtgaatttgcattgaattgaatggtga 257  Q
    ||||||||||||      || ||||||||||||||||||||||||||||||||||||||||||    
51674279 gttgtaaccgccatgatgatgatgatgatgatgaaagtgaatttgcattgaattgaatggtga 51674341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University