View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8703_low_12 (Length: 264)
Name: NF8703_low_12
Description: NF8703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8703_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 21 - 258
Target Start/End: Original strand, 15751958 - 15752195
Alignment:
| Q |
21 |
atggctgcaatttcagttgcagactgcaatttagagctctagtcgtccccgagaaatgtgctatagcaagttacatggaaaattacaatgatttctttaa |
120 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15751958 |
atggctgcaatttcagttgcggactgcaatttagaactctagtcgtccccgagaaatgtgctatagcaagttacatggaaaattacaatgatttctttaa |
15752057 |
T |
 |
| Q |
121 |
acattgtagggatttatcaaggcattgctaaatctaattttaccttcatagttctctctcaactgaaggtgacttaagccgaaagtcttgtctttactct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15752058 |
acattgtagggatttatcaaggcattgctaaatctaattttaccttcatagttctctctcaactgaaggtgacttgagccgaaagtcttgtctttactct |
15752157 |
T |
 |
| Q |
221 |
tattatcatttgttttaatattttcattttcttctctc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15752158 |
tattatcatttgttttaatattttcattttcttctctc |
15752195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University