View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8704_low_2 (Length: 385)
Name: NF8704_low_2
Description: NF8704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8704_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 57 - 369
Target Start/End: Original strand, 6680672 - 6680984
Alignment:
| Q |
57 |
ctggctccatccaaatattttcatttcaactttattc-aaaactatttagaatcttccatcttccaaccaaagtatcatcataagtcataaccatccaac |
155 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6680672 |
ctggctccatc-aaatattttcatttcaactttattccaaaactatttagaatcttccatcttccaaccaaagtatcatcataagtcataaccatccaac |
6680770 |
T |
 |
| Q |
156 |
tgtgcaaacacaagaaggtgcatagaattattaaacctttatcgcaccgtaaaatttctctttatccttatccagcgcgcaccacttcaacatctctcac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6680771 |
tgtgcaaacacaagaaggtgcatagaattattaaacctttaccgcaccgtaaaatttctctttatccttatccggcgcgcaccacttcaacatctctcac |
6680870 |
T |
 |
| Q |
256 |
cgtcatgtcgccggaaacacacttgccgccgccggaacctccgatcatatccttaccggaaatcgcaccagaaacaacggcggcgcaagaaaacgccgat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6680871 |
cgtcatgtcgccggaaacacacttgccgccgccggaacctccgatcatatccttaccggaaatcgcaccagaaacaacggcggcgcaagaaaacgccgat |
6680970 |
T |
 |
| Q |
356 |
atccccgctcctcc |
369 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6680971 |
atccccgctcctcc |
6680984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University