View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8704_low_3 (Length: 302)
Name: NF8704_low_3
Description: NF8704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8704_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 14 - 287
Target Start/End: Complemental strand, 39956303 - 39956030
Alignment:
| Q |
14 |
agattaacaggtccctcagaaggcaatgcaacaaaggaagagcaaactgcaaaggttgcaccgattgcaaagagaacaccaccaaaactccatgaaagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39956303 |
agattaacaggtccctcagaaggcaatgcaacaaaggaagagcaaactgcaaaggttgcaccgattacaaagagaacaccaccaaaactccatgaaagaa |
39956204 |
T |
 |
| Q |
114 |
ggaaatgcatgaagccaaaacttgagattgttaaaccaaatttacaatatcacaaacaaccaggtgcatcaccttcttctaagtcaagaaattctagctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39956203 |
ggaaatgcatgaagccaaaacttgagattgttaaaccaaatttacaatatcacaaacaaccaggtgcatcaccttcctctaagtcaagaaattctagctt |
39956104 |
T |
 |
| Q |
214 |
tccttcaagtcctgtatcaggtagtggaagttctagtcttcttccaagccctaccacaccttcaacattgttct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956103 |
tccttcaagtcctgtatcaggtagtggaagttctagtcttcttccaagccctaccacaccttcaacattgttct |
39956030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University