View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8704_low_5 (Length: 240)
Name: NF8704_low_5
Description: NF8704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8704_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 33732706 - 33732483
Alignment:
| Q |
1 |
agaaatttcccacatctattttccatcaattttttacattagtgcaatcttgtatgagatcttttgtatagttctggtgtgagtaatttagtttcacctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
33732706 |
agaaatttcccacatctattttccatcaattttttacattagtgcaatcttgtatgagatcttttgtatagttctggtgtgactgatttagtttcacctc |
33732607 |
T |
 |
| Q |
101 |
gactatgaatgcaaaaagtggtgttagatatataaaagagatgattcataatattcaacgtcttaagattttaggtggagatttagtgtcattttctcga |
200 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
33732606 |
gactctgaatgctaaaagtggtgttagatatataaaagaggtgattcataatattcaacgtcttaaggttttaggtggagatttagtgtcatcttctcag |
33732507 |
T |
 |
| Q |
201 |
cgattcgccaatctacctaataat |
224 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
33732506 |
cgattcgccaatctccctaataat |
33732483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University