View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8706_high_2 (Length: 330)
Name: NF8706_high_2
Description: NF8706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8706_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 40676734 - 40677046
Alignment:
| Q |
1 |
acaatatgagtgttggagaataatgtgcaagaaggaaatgaacagaacacattctccttcttgtgatccttcttttcttgattgtaccacacttcttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
40676734 |
acaatatgagtgttggagaataatgtgcaagaaggaaatgaacagaacacattctccttcttgtgatccttcttttcttgattgtagcacacttgttaat |
40676833 |
T |
 |
| Q |
101 |
aatgaacgtcaagtttggttcagacgcactagagtcctcacagcttgtgatgcactcaatgataaaaatcactttcagtttggaatgtttgctgatgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40676834 |
aatgaacgtcaagtttggttcagacgcactagagtcctcacagcttgtgatgcattccaggataaaaatcactttcagtttggaatgtttgctgatgctt |
40676933 |
T |
 |
| Q |
201 |
ttactgatcacgtctcttcctcaagattcttccaaaaatatttttattgcctctggtggggtttgaaaaatctaaggtttcttctactctctactcttta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40676934 |
ttactgatcacgtctcttcctcaagattcttccaaaaatatttttattgcctctggtggggtttgaaaaatctaaggtttcttctactctctactcttta |
40677033 |
T |
 |
| Q |
301 |
cctattttcattt |
313 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
40677034 |
cctattttgattt |
40677046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University