View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8707_high_13 (Length: 240)
Name: NF8707_high_13
Description: NF8707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8707_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 44345335 - 44345557
Alignment:
| Q |
1 |
tgtcacaaggtaccaaaacctttgcatccacacactggcacaattctccaacacagcaggaagaaccccaagcaaatgggcacgtgcgggtgtgtcggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44345335 |
tgtcacaaggtaccaaaacctttgcatccacacactagcacaattctccaacacagcaggaagaaccccaagcaaatgggcacgtgcgggtgtgtcggta |
44345434 |
T |
|
| Q |
101 |
acgataagcgaagttaagaatgttcaagcatatcttacaaaattaaagaagaacgggaagatgaaaggaagaaacagagttgcactttcagattgtatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44345435 |
acgataagcgaagttaagaatgttcaagcatatcttacaaaattaaagaagaacgggaagatgaaaggaagaaacagagttgcactttcagactgtatag |
44345534 |
T |
|
| Q |
201 |
aaacttttggctatgcacttgat |
223 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
44345535 |
aaacttttggctatgcagttgat |
44345557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University