View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8707_high_3 (Length: 345)
Name: NF8707_high_3
Description: NF8707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8707_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 13213080 - 13213284
Alignment:
| Q |
17 |
aggatgaagatgaaggtctctagtgagaaatggaggtggaagaggacgaccttgtgctacttgatccatgatttgnnnnnnnnnncttctctagatgata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13213080 |
aggatgaagatgaaggtctctagtgagaaatggaggtggaagaggacgaccttgtgctacttgatccatgatttgttttttttttcttctctagatgata |
13213179 |
T |
 |
| Q |
117 |
taatcaagatcaatatcttcaaaaagtcacaaccctagattgtttgaaaattgaaaagaaggaaagtagagagataggaaaggatctaggttgtggtggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13213180 |
taatcaagatcaatatcttcaaaaagtcacaaccctagattgtttgaaaattgaaaagaaggaaaggagagagataggaaaggatctaggttgtggtggt |
13213279 |
T |
 |
| Q |
217 |
ggaga |
221 |
Q |
| |
|
||||| |
|
|
| T |
13213280 |
ggaga |
13213284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 287 - 334
Target Start/End: Original strand, 13213349 - 13213396
Alignment:
| Q |
287 |
agttgaagaactagctaggtgttgttgatggcatgttctctactctct |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213349 |
agttgaagaactagctaggtgttgttgatggcatgttctctactctct |
13213396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University