View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8707_low_13 (Length: 246)
Name: NF8707_low_13
Description: NF8707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8707_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 18348500 - 18348283
Alignment:
| Q |
19 |
gtattaacatttggattatttttgcttttaatttatgtttgggtcttgtgttgtaacatttgaatactggtgatactattttcaannnnnnnnnnnnnnn |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18348500 |
gtattaacatttggattatttttgcttttaatttatgtttgggtcttgtgttgtaacatttgaatactggtgatactattatcaatttttttgttgtttt |
18348401 |
T |
|
| Q |
119 |
ngtttcatatgcttccattacatttgtgctagcttttaatatgttttgatgcatgttgaaagcaatccgaattcgtcaatttgccggaaaaaagtggaaa |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
18348400 |
-gtttcatatgctttcattacatttgtgctagcttttaatatgttttgatgcatgttgaaagcaatccaaattcgtcaatttgccggaaaaaagtgttaa |
18348302 |
T |
|
| Q |
219 |
ctaatgaacacaggttctg |
237 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
18348301 |
ctaatgaacccaggttctg |
18348283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 185
Target Start/End: Original strand, 40683070 - 40683131
Alignment:
| Q |
120 |
gtttcatatgcttccattacatttgtgctagcttttaatatgttttgatgcatgttgaaagcaatc |
185 |
Q |
| |
|
||||||| |||||| ||||||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
40683070 |
gtttcatgtgcttcaattacattt----tagctaataatttgttttgatgcatgttgaaagcaatc |
40683131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University