View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8707_low_15 (Length: 241)
Name: NF8707_low_15
Description: NF8707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8707_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 141 - 223
Target Start/End: Complemental strand, 16431951 - 16431869
Alignment:
| Q |
141 |
aattataaaaatattagtaagagaaaatgtcgattgcaataatgaaaagggaaaatgcgtgatgtggaagctatgagtcatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16431951 |
aattataaaaatattagtaagagaaaatgtcgattgcaataatgaaaagggaaaatgcgtgatgtggaagctatgagtcatgt |
16431869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 16432082 - 16431999
Alignment:
| Q |
10 |
tcgtgttaccgttgccttgacgtgtttgtggataacaaagaaattaagttgtgatgtttggttgagtaaaaataaacatgtgat |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16432082 |
tcgtgttaccgttgccttgacgtgtttgtggataacaaagaaattaagttgtgatgtttggttaagtaaaaataaacatgtgat |
16431999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University