View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8707_low_17 (Length: 240)
Name: NF8707_low_17
Description: NF8707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8707_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 3469983 - 3469780
Alignment:
| Q |
20 |
cctataacaaaagccctatttcttctctctctaaattttcattgcgttgttttttgaggttattcttattcccatcattctcgtatattgagtctgtgta |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469983 |
cctataacaaaaggcctatttcttctctctctaaattttcattgcgttgttttttgaggttattcttattcccatcattctcgtatattgagtctgtgta |
3469884 |
T |
 |
| Q |
120 |
tggcagtaagattatcactctcaacgcatgaagtttccgacctctccctcggcaaaccaccactccgctccatttctatcaccgacaccgtagccgacgc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3469883 |
tggcagtaagattatcactctcaacgcatgaagtttccgacctctccctcggcaaaccaccactccgctccatttctatcaccgacaccatagccgacgc |
3469784 |
T |
 |
| Q |
220 |
tctt |
223 |
Q |
| |
|
|||| |
|
|
| T |
3469783 |
tctt |
3469780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University