View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8707_low_9 (Length: 265)
Name: NF8707_low_9
Description: NF8707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8707_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 2425382 - 2425142
Alignment:
| Q |
7 |
gtttctatgttggagttgaggatggtgacacttgatgagagttgaacatgaataccatcagtgttgggactatttcctgctgctgttaccttaacccctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2425382 |
gtttctatgttggagttgaggatggtgacacttgatgagagttgaacatgaataccatcagtgttgggactatttcctgctgctgttaccttaacccctt |
2425283 |
T |
|
| Q |
107 |
gtactttcacattattgcatctgtctatcactatgtggaacatttggctattcaaggatgttacaccattcataacaatgttgttggaattggaaaatct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2425282 |
gtactttcacattattgcatctgtctatcactatgtggaacatttggctattcaaggatgttacaccattcataacaatgttgttggaattggaaaatct |
2425183 |
T |
|
| Q |
207 |
taagttct----gtaattgtatacaattaaattggcatcaa |
243 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
2425182 |
taagttctgtacgtaattgtatacaataaaattggcatcaa |
2425142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 231 - 265
Target Start/End: Complemental strand, 2425106 - 2425072
Alignment:
| Q |
231 |
aaattggcatcaataatactatgagttcatagatc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2425106 |
aaattggcatcaataatactatgagttcatagatc |
2425072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University