View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8708_high_5 (Length: 209)
Name: NF8708_high_5
Description: NF8708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8708_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 33 - 192
Target Start/End: Original strand, 53046202 - 53046362
Alignment:
| Q |
33 |
cagagagtatgcaagctatacaagttaactcagtatgtcatcttgtctgtttgtagtggccattctagcccctcattttgtatgggcaatttataataaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53046202 |
cagagagtatgcaagctatacaagttaactcagtatgtcatcttgtctgtttgtagtggccattctagcccctcattttgtatgggcaatttataataaa |
53046301 |
T |
 |
| Q |
133 |
at-aaaataatcacaatttttcttttcattgtcttcgtcaaccaggctgcttccgccttga |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53046302 |
ataaaaataatcacaatttttcttttcattgtcttcgtcaaccaggctgcttcctccttga |
53046362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University