View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8708_low_2 (Length: 296)
Name: NF8708_low_2
Description: NF8708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8708_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 17 - 175
Target Start/End: Original strand, 26948860 - 26949017
Alignment:
| Q |
17 |
agaacttacacatattgcattaccaaaatttggaatgtttttaattaatgaaaaacttactcttagtgactagaataataaaaatactcatagcttgacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26948860 |
agaacttacacatattgcattaccaaaatttggaatgtttt-aattaatgaaaaacttactcttagtgactagaataataaaaatactcatagcttgacc |
26948958 |
T |
 |
| Q |
117 |
attacactaatagaaaaatattcatagcttgacaattacacccatttaatgatatttat |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26948959 |
attacactaatagaaaaatattcatagcttgacaattacacccatttaatgatatttat |
26949017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University