View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8708_low_3 (Length: 294)
Name: NF8708_low_3
Description: NF8708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8708_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 284
Target Start/End: Complemental strand, 35071142 - 35070876
Alignment:
| Q |
17 |
aaaataattgtgacatgtaaccaaattcttcttgaaaactagtctacattttcccttgtgtaatcaaatgtaaggcctttaaaagggggatttgatgctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35071142 |
aaaataattgtgacatgtaaccaaattcttcttgaaaactagtctacattttcccttgtgtaatcaaatgtaaggcctttaaaagggggatttgatgctc |
35071043 |
T |
|
| Q |
117 |
atgtccctttcaatgtaatggcaaaattattttgttgtttgagtacagattctccaacatgtgtagtcaaagaatgcatctaannnnnnnnncacatcag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35071042 |
atgtccctttcaatgtaatggcaaaattattttgttgtttgagtacagattctccaacatgtgtagtcaaagaatgcatctaa-ttttttttcacatcag |
35070944 |
T |
|
| Q |
217 |
ctggaactagaagcacaaatctgtcacattcaaatgccatgcctgatccagcttacatctcagtataa |
284 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35070943 |
ctggaactagaagcgcaaatctgtcacattcaaatgccatgcctgatccagcttacatctcagtataa |
35070876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University