View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8709_low_5 (Length: 410)
Name: NF8709_low_5
Description: NF8709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8709_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 16 - 145
Target Start/End: Original strand, 25690391 - 25690520
Alignment:
| Q |
16 |
aatttttccatctctagctttctctttctttgtcacatatcttggcaaagctccatcagatagtatatagttcccatcccacatcaaaccataatcatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25690391 |
aatttttccatctctagctttctctttctttgtcacatatcttggcaaagctccatcagatagtatatagttcccatcccacatcaaaccataatcatca |
25690490 |
T |
 |
| Q |
116 |
cgtctcttctacatcaaaccattctatatc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25690491 |
cgtctcttctacatcaaaccattctatatc |
25690520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 282 - 403
Target Start/End: Original strand, 25690655 - 25690776
Alignment:
| Q |
282 |
cgatgttattagtcgaaccaacatcttggtctctccatcaccaccaacctccatggttcaattctcaaatccatgaaaacacaccccattacaacctcaa |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25690655 |
cgatgttattagtcgaaccaacatcttggtctctccatcaccaccaacctccatggttcaattctcaaatccatgaaaacacaccccattacaacctcaa |
25690754 |
T |
 |
| Q |
382 |
aaacatagaagatgaagaatta |
403 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25690755 |
aaacatagaagatgaagaatta |
25690776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 25690587 - 25690632
Alignment:
| Q |
214 |
ctttccttgttacatggatctttcagaaacatcactctggtggact |
259 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25690587 |
ctttctttgttacatggatctttcagaaacatcactctggtggact |
25690632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University