View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8709_low_7 (Length: 346)
Name: NF8709_low_7
Description: NF8709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8709_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 4802784 - 4803113
Alignment:
| Q |
1 |
tcaggttgtttctcttgaatgttctgtgtatttcattactgattcacgattgtctttgagagcttaatcatgcttggtttgggttactttacattcatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4802784 |
tcaggttgtttctcttgaatgttctgtgtatttcattactgattcacaattgtctttgagagcttaatcatgcttggtttgggttactttacattcatat |
4802883 |
T |
|
| Q |
101 |
cctttctgatcttagtatataactatatatgcatttgtttcttcgttaaagcattccacaggacttgccatataagaagcttttggggatcagtaatga- |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4802884 |
cctttctgatcttagtatataactatatatgcatttgtttcttagttaaagcattccgcgggacttgccatataagaagcttttggggatcaataatgat |
4802983 |
T |
|
| Q |
200 |
nnnnnnnnnnnnnaacatttat-atattccatctaatcttgttataggtttaagcgataattattgactagaacttataaaaggtgtttttattgggaaa |
298 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4802984 |
ttttttttttttttacatttataatattccatctaatcttgttataggtttaagtgataattattgactagaacttataaaagctgtttttattgggaaa |
4803083 |
T |
|
| Q |
299 |
agattgattaaaatagcttttgcttccatc |
328 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
4803084 |
agattgattaaaataacttttgcttccatc |
4803113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University