View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8709_low_8 (Length: 333)

Name: NF8709_low_8
Description: NF8709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8709_low_8
NF8709_low_8
[»] chr5 (1 HSPs)
chr5 (47-317)||(15935689-15935959)


Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 47 - 317
Target Start/End: Original strand, 15935689 - 15935959
Alignment:
47 agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15935689 agtaattcgatttgtacgagggaaaaggaaagatagaacggctcccaaaggagcgaacatggtttgtaactccgcttcgaggatgcgatctgcttcgcct 15935788  T
147 tcgttgaggttagaaagctttttgccgaggagctcgtataattcatcgtcggggagacgagatatcacaaatttggggaggtaagggaccttgtttgcca 246  Q
    |||  ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||    
15935789 tcggggaggttagaaagctttttgccgaggagctcgtataattcatcgtcggagagacgagatattacaaatttggggaggtaagagaccttgtttgcca 15935888  T
247 atctgatggccacttgccgaatgagtgggtcgaacttttcgtccacgacgttgccggagccggaagccatc 317  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
15935889 atctgatggccacttgccgaatgagcgggtcgaacttttcgtccacgacgttgccggagccggaagccatc 15935959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University