View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8710_high_8 (Length: 227)
Name: NF8710_high_8
Description: NF8710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8710_high_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 12199436 - 12199210
Alignment:
| Q |
1 |
taaaaagggaaaggggttttggccatcctcactaaataccaacgctacacca-tcctttggattcatctacgacttctaaagctgcagctatgcgattat |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12199436 |
taaaaagggaaaggggtcttggccatcctcactaaataccaacgctacaccaatcctttggattcatctatgacttctaaagctgcagctatgcgattat |
12199337 |
T |
|
| Q |
100 |
tgaaaatgctttccttcttggacttccaaatcacccaaattaccgaatgccaaaccaatttcaattctttcctcaccttcttgctgctgccagacccaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12199336 |
tgaaaatgctttccttcttggacttccaaatcacccaaattaccgaatgccaaaccaatttcaattctttcctcaccttcttactgctgccagacccaga |
12199237 |
T |
|
| Q |
200 |
taaaaaagaacaagaaacaaacaagtct |
227 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
12199236 |
taaaaaa-aacaagaaacaaacaagtct |
12199210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University