View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8710_low_13 (Length: 255)
Name: NF8710_low_13
Description: NF8710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8710_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 60 - 240
Target Start/End: Original strand, 8583587 - 8583773
Alignment:
| Q |
60 |
ctcatttttcattaaaataataatttattgctatttaatttggtctttgtaacgnnnnnnnatttcttggtct------gtgtctgtggttgatgtttgt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
8583587 |
ctcatttttcattaaaataataatttattgctatttaatttggtctttgtaacgtttttttatttcttggtctgtgtctgtgtctgtggttgatgtttgt |
8583686 |
T |
 |
| Q |
154 |
attgagatttgcgtctgtctttgtgctgtgtcatattaaggtcgtttatttctatgttgttgttgtttttaatttattgattttgtt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8583687 |
attgagatttgcgtctgtctttgtgttgtgtcatattaaggtcggttatttctatgttgttgttgtttttaatttattgattttgtt |
8583773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University