View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8710_low_16 (Length: 239)
Name: NF8710_low_16
Description: NF8710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8710_low_16 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 13516 - 13739
Alignment:
| Q |
1 |
ttcaatttgatttacactcaatggaaacatataattttccaaactagaattatagatttaggctagccaaaaaatcatgaaaccaccaaaa------gtc |
94 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
13516 |
ttcaatttgatttgcactcgatgggaacatataattgtccaaactaaaattatagatttaggctagccaaaaaatcatgaaaccaccgaaaaactgagtt |
13615 |
T |
|
| Q |
95 |
tcaaattttctcatgctttataaatatagttgtaaacctcaatttttaacttatgaaatttg-tgttccaatcacctcaaatgtatagattcagtttgtt |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13616 |
tcaaattttcaaatgctttataaatatagttgtaaacctgaatttttaaattatgaaattttatgttccaatcacctcaaatgtatagattcagcttgtt |
13715 |
T |
|
| Q |
194 |
ttgctttgttatttttgttatcaa |
217 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
13716 |
ttcatttgttatttttgttatcaa |
13739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University