View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8711_high_3 (Length: 298)

Name: NF8711_high_3
Description: NF8711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8711_high_3
NF8711_high_3
[»] chr2 (2 HSPs)
chr2 (93-235)||(41692487-41692629)
chr2 (164-238)||(42970592-42970666)
[»] chr8 (2 HSPs)
chr8 (238-283)||(31268413-31268458)
chr8 (164-230)||(41415534-41415600)
[»] chr3 (2 HSPs)
chr3 (164-237)||(4475738-4475811)
chr3 (164-238)||(42740926-42741000)
[»] chr5 (1 HSPs)
chr5 (164-237)||(33694434-33694507)


Alignment Details
Target: chr2 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 41692629 - 41692487
Alignment:
Q  93 aaaaccgtaatccgtcgaaactgcaaactgacgaaaccgaatgcataaatggacgggaatggatgtagattgct-caaccgtgggtacaaacggattggt 191  Q
    |||||||| | |||| ||||| |||||| |||||||||||||||| ||| |||||||||||| ||||| || || ||||||||||| |||||| ||||||    
T  41692629 aaaaccgtcacccgttgaaaccgcaaaccgacgaaaccgaatgcaaaaacggacgggaatgggtgtag-ttactgcaaccgtgggttcaaacgaattggt 41692531  T
Q  192 ggtttcggtccgccctcgaccgaaaccgaccgtttgtccgcccc 235  Q
    |||||||||||| |  |||| |||||||||||||||||| ||||    
T  41692530 ggtttcggtccgtcgccgacagaaaccgaccgtttgtccacccc 41692487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 238
Target Start/End: Original strand, 42970592 - 42970666
Alignment:
Q  164 gctcaaccgtgggtacaaacggattggtggtttcggtccgccctcgaccgaaaccgaccgtttgtccgcccctac 238  Q
    ||||||||||||||   ||||||||||   |||||||||| |  ||||||||||||||||||||||| |||||||    
T  42970592 gctcaaccgtgggtttgaacggattggcattttcggtccgtcgccgaccgaaaccgaccgtttgtccacccctac 42970666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 283
Target Start/End: Original strand, 31268413 - 31268458
Alignment:
Q  238 ctttagaccctttatctttataaaaagttatgattatgatcccctt 283  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||    
T  31268413 ctttagaccctttatctttataaaaagttgtgattatgatcccctt 31268458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 230
Target Start/End: Original strand, 41415534 - 41415600
Alignment:
Q  164 gctcaaccgtgggtacaaacggattggtggtttcggtccgccctcgaccgaaaccgaccgtttgtcc 230  Q
    ||||||||||||||   ||||||||||   |||||||||| |  |||||||||||||||||||||||    
T  41415534 gctcaaccgtgggtttgaacggattggcattttcggtccgtcaccgaccgaaaccgaccgtttgtcc 41415600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 237
Target Start/End: Complemental strand, 4475811 - 4475738
Alignment:
Q  164 gctcaaccgtgggtacaaacggattggtggtttcggtccgccctcgaccgaaaccgaccgtttgtccgccccta 237  Q
    ||||||||||||||   ||||||||||   |||||||||| |  ||||||||||||||||||||||| ||||||    
T  4475811 gctcaaccgtgggtttgaacggattggcattttcggtccgtcgccgaccgaaaccgaccgtttgtccaccccta 4475738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 238
Target Start/End: Original strand, 42740926 - 42741000
Alignment:
Q  164 gctcaaccgtgggtacaaacggattggtggtttcggtccgccctcgaccgaaaccgaccgtttgtccgcccctac 238  Q
    ||||||||||||||   ||||||||||   ||||||||||    ||||||||||||||||||||||| |||||||    
T  42740926 gctcaaccgtgggtttgaacggattggcattttcggtccgttgccgaccgaaaccgaccgtttgtccacccctac 42741000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 237
Target Start/End: Original strand, 33694434 - 33694507
Alignment:
Q  164 gctcaaccgtgggtacaaacggattggtggtttcggtccgccctcgaccgaaaccgaccgtttgtccgccccta 237  Q
    ||||||||||||||   ||||||||||   ||||||||||    ||||||||||||||||||||||| ||||||    
T  33694434 gctcaaccgtgggtttgaacggattggcattttcggtccgttgccgaccgaaaccgaccgtttgtccaccccta 33694507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University