View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8711_high_5 (Length: 246)
Name: NF8711_high_5
Description: NF8711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8711_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 24884898 - 24885130
Alignment:
| Q |
1 |
acaatcaactcactttgatgttgagcagtattgatggctcaataaccaatcagctcggtcttgttgaaa-aagtcgaatagtgacataaggttttatcaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
24884898 |
acaatcaactcactttgatgttgagcagtattgatggctcaataaccaatcagctcgatcttgtggaaagaagtcgaacagtgacataaggttttatcaa |
24884997 |
T |
|
| Q |
100 |
ggcagtgagcccttagtattgtgatggccctgagtggatcaaagagtgagtacgaggcctgacctgagagattctttaataagaaggtggcctttgagct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884998 |
ggcagtgagcccttagtattgtgatggccctgagtggatcagagagtgagtacgaggcctgagctgagagattctttaataagaaggtggcctttgagct |
24885097 |
T |
|
| Q |
200 |
taatttggccaagttggagccgacgttgttgat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24885098 |
taatttggccaagttggagccgacgttgttgat |
24885130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University