View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8711_high_7 (Length: 219)
Name: NF8711_high_7
Description: NF8711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8711_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 31263808 - 31263697
Alignment:
| Q |
15 |
aagaaatagattacttgcttgtacaattgtgctcatctacttcaagctgttggttatatgaaaatatcggttgaacactacaaaattttaataaccactc |
114 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31263808 |
aagaaatagattatttgcttgtacaattatgctcatctgcttcaagctgttggttatatgaaaatatcggttgaacactacaaaattttaataaccactc |
31263709 |
T |
 |
| Q |
115 |
caatgaagtacc |
126 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31263708 |
caatgaagtacc |
31263697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 108
Target Start/End: Original strand, 15853835 - 15853888
Alignment:
| Q |
55 |
ttcaagctgttggttatatgaaaatatcggttgaacactacaaaattttaataa |
108 |
Q |
| |
|
|||||||| |||| || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15853835 |
ttcaagctattggataattgaaaatatttgttgaacactacaaaattttaataa |
15853888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University