View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8711_low_1 (Length: 524)
Name: NF8711_low_1
Description: NF8711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8711_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 486; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 486; E-Value: 0
Query Start/End: Original strand, 1 - 506
Target Start/End: Original strand, 28036761 - 28037266
Alignment:
| Q |
1 |
cttaacaaccattgaacatctccaagggaattttctaactgcattgaggttttgcgaaaggcggcggtgggaatgatggtgaagagacgttttatgccgt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28036761 |
cttaacaaccattgaatatctccaagggaattttctaactgcattgaggttttgcgaaaggcggtggtgggaatgatggtgaagagacgttttatgccgt |
28036860 |
T |
|
| Q |
101 |
ttacacgacatttcatgactaatccaagggctttgtcgaggacttgttcagtgtcatcgatgattcgtcttgtgggacgttcatataggtcattgctatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28036861 |
ttacacgacatttcatgactaatccaagggctttgtcgaggacttgttctgtgtcatcgatgattcgtcttgtgggacgttcatataggtcattgctatt |
28036960 |
T |
|
| Q |
201 |
ccttgcagcttgtcgaagaaggcctgcgagtttttctgttttggtttttaattctagacattcttgtttgaaattttgtgcctcgtccgctgatttagat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28036961 |
ccttgcagcttgtcgaagaaggcctgcgagtttttctgttttggtttttaattctagacattcttgtttgaaattttgtgcctcgtccgctgatttagat |
28037060 |
T |
|
| Q |
301 |
acctggtccgccatttgtatcggccgagccaggatctccttcacgatgctcgacatggtggcggtgatacgttgttattgttgttgttttttgtttatgc |
400 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28037061 |
acctggtcagccatttgtatcggccgagccaggatctccttcacgatgctcgacatggtggcggtgatacgttgttattgttgttgtcttttgtttatgc |
28037160 |
T |
|
| Q |
401 |
aaacttttagtattgagggaagcaatgtaatgtgtaaatgttttgttgtatgtggggccaaggaggttctggctgtgggcggtggtgggaatgtgtatgc |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28037161 |
aaacttttagtattgagggaagcaatgtaatgtgtaaatgttttgttgtatgtggggccaaggaggttctggctgtgggcggtggtgggaatgtgtatgc |
28037260 |
T |
|
| Q |
501 |
attcta |
506 |
Q |
| |
|
|||||| |
|
|
| T |
28037261 |
attcta |
28037266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 182
Target Start/End: Complemental strand, 8756284 - 8756206
Alignment:
| Q |
104 |
cacgacatttcatgactaatccaagggctttgtcgaggacttgttcagtgtcatcgatgattcgtcttgtgggacgttc |
182 |
Q |
| |
|
|||||||||| | ||||||| ||| ||||||||||| |||||||| || || |||||||| ||| |||| |||||||| |
|
|
| T |
8756284 |
cacgacattttaggactaatgaaagtgctttgtcgagtacttgttctgtttcttcgatgatccgttttgttggacgttc |
8756206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University