View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8711_low_10 (Length: 257)
Name: NF8711_low_10
Description: NF8711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8711_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 7567558 - 7567796
Alignment:
| Q |
1 |
ggcaacaacaagggaagatttatattatgaggatttgcatcactatgcttcttaattggcataagtatgcttagtcataagcacnnnnnnnagtattctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7567558 |
ggcaacaacaagggaagatttatattatgaggatttgcatcactatgcttcttaattggcataagtatgcttagtcataagcactttttttagtattctc |
7567657 |
T |
|
| Q |
101 |
ctaatcagcttttagttttaggtgttatatatattatctacctagatagctcaatggattgtactatttgactgttgagcatagtcactatagcatatag |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7567658 |
ctaatcagcgtttagttttaggtgttatatatattatctacctagatagctcaatggattgtactatttgactgttgagcatagtcactatagcatatag |
7567757 |
T |
|
| Q |
201 |
tagtactagtaaatgaatttgtgtatgtaataacattaa |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7567758 |
tagtactagtaaatgaatttgtgtatgtaataacattaa |
7567796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 48675864 - 48675798
Alignment:
| Q |
1 |
ggcaacaacaagggaagatttatattatgaggatttgcatcactatgcttcttaattggcataagta |
67 |
Q |
| |
|
|||||||| | ||||| ||||||||||||| | || ||| ||||||||||||||||||||||||| |
|
|
| T |
48675864 |
ggcaacaaaaggggaaactttatattatgagagtgtgtatctctatgcttcttaattggcataagta |
48675798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University