View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8711_low_14 (Length: 219)

Name: NF8711_low_14
Description: NF8711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8711_low_14
NF8711_low_14
[»] chr6 (1 HSPs)
chr6 (15-126)||(31263697-31263808)
[»] chr2 (1 HSPs)
chr2 (55-108)||(15853835-15853888)


Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 31263808 - 31263697
Alignment:
15 aagaaatagattacttgcttgtacaattgtgctcatctacttcaagctgttggttatatgaaaatatcggttgaacactacaaaattttaataaccactc 114  Q
    ||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31263808 aagaaatagattatttgcttgtacaattatgctcatctgcttcaagctgttggttatatgaaaatatcggttgaacactacaaaattttaataaccactc 31263709  T
115 caatgaagtacc 126  Q
    ||||||||||||    
31263708 caatgaagtacc 31263697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 108
Target Start/End: Original strand, 15853835 - 15853888
Alignment:
55 ttcaagctgttggttatatgaaaatatcggttgaacactacaaaattttaataa 108  Q
    |||||||| |||| ||  |||||||||  |||||||||||||||||||||||||    
15853835 ttcaagctattggataattgaaaatatttgttgaacactacaaaattttaataa 15853888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University