View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8711_low_9 (Length: 274)
Name: NF8711_low_9
Description: NF8711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8711_low_9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 80 - 274
Target Start/End: Complemental strand, 35835317 - 35835123
Alignment:
| Q |
80 |
ccaaatcaacaaaccctaaaatcaaaactacgcaatcaacgtttcaaagtagaaacattttcccgtcgattagcctccgaacaagttccaattcgagtcc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835317 |
ccaaatcaacaaaccctaaaatcaaaactacgcaatcaacgtttcaaagtagaaacattttcccgtcgattagcctccgaacaagttccaattcgagtcc |
35835218 |
T |
|
| Q |
180 |
acgatgttttcataaccggaaacaccaaaaccaaagattggataatcgaagctgaactcgatggaatcgagaaagccactacaatgcaggaactc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35835217 |
acgatgttttcataaccggaaacaccaaaaccaaagattggataatcgaagctgaactcgatggaatcgagaaagccactacaatgcaggaactc |
35835123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 249
Target Start/End: Complemental strand, 32053222 - 32053136
Alignment:
| Q |
163 |
agttccaattcgagtccacgatgttttcataaccggaaacaccaaaaccaaagattggataatcgaagctgaactcgatggaatcga |
249 |
Q |
| |
|
||||||||| ||||||||||| || | || ||| ||||| ||||||||||||||| | ||||||||||||||| | |||||||| |
|
|
| T |
32053222 |
agttccaatccgagtccacgacgtgataattcgcggcaacacgaaaaccaaagattgggtgatcgaagctgaactcaagggaatcga |
32053136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University