View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8715_high_5 (Length: 239)
Name: NF8715_high_5
Description: NF8715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8715_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 146 - 236
Target Start/End: Complemental strand, 42100592 - 42100502
Alignment:
| Q |
146 |
tgatggagtgattgtaaatattgaagtcttatcgacaaatcaaagttttacggcaatgtaacatttttcaattaaaaaatattggaaaatc |
236 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42100592 |
tgatggagtaattgtaaatattgaagtcttatcgaaaaatcaaagttttacggcaatgtaacatttttcaaataaaaaatattggaaaatc |
42100502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 42101022 - 42100929
Alignment:
| Q |
18 |
tatctttgggctcgataaatcaagagaaaacagggagagaatttagggctaaacgt-aaggtaaaacatatgaccaatgagaaaattaactagg |
110 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42101022 |
tatctttggactcgataaatcaagaaaaaacagggagagaatttagggctaaacgtaaaggtaaaacatatgaccaatgagaaaatcaactagg |
42100929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University