View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8715_low_6 (Length: 255)
Name: NF8715_low_6
Description: NF8715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8715_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 236
Target Start/End: Complemental strand, 45294174 - 45293948
Alignment:
| Q |
10 |
actataaaatatccacacttgactttggatttatataagagtgaagaaattactcattttagcttgcattatcacagaaaatcatgaagcatttgtgaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45294174 |
actataaaatatccacacttgactttggatttatataagagtgaagaaattacccattttagcttgcattatcacagaaaagcatgaagcatttgtgaaa |
45294075 |
T |
|
| Q |
110 |
gggctttgtatagaactgtatgcaaagcccttttcactcactttcttgcaaattaatgaattatgcagttttagcttnnnnnnntatcactatgtgatgg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45294074 |
gggctttgtatagaactgtatgcaaagcccttttcactcactttcttgcaaattaatgaattatgcagttttagcttaaaaaaatatcactatgtgatgg |
45293975 |
T |
|
| Q |
210 |
acaagaatatgagttcaacatagttat |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45293974 |
acaagaatatgagttcaacatagttat |
45293948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University