View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8715_low_8 (Length: 239)

Name: NF8715_low_8
Description: NF8715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8715_low_8
NF8715_low_8
[»] chr1 (2 HSPs)
chr1 (146-236)||(42100502-42100592)
chr1 (18-110)||(42100929-42101022)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 146 - 236
Target Start/End: Complemental strand, 42100592 - 42100502
Alignment:
146 tgatggagtgattgtaaatattgaagtcttatcgacaaatcaaagttttacggcaatgtaacatttttcaattaaaaaatattggaaaatc 236  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
42100592 tgatggagtaattgtaaatattgaagtcttatcgaaaaatcaaagttttacggcaatgtaacatttttcaaataaaaaatattggaaaatc 42100502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 42101022 - 42100929
Alignment:
18 tatctttgggctcgataaatcaagagaaaacagggagagaatttagggctaaacgt-aaggtaaaacatatgaccaatgagaaaattaactagg 110  Q
    ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||    
42101022 tatctttggactcgataaatcaagaaaaaacagggagagaatttagggctaaacgtaaaggtaaaacatatgaccaatgagaaaatcaactagg 42100929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University