View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8716_low_2 (Length: 218)
Name: NF8716_low_2
Description: NF8716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8716_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 933878 - 933687
Alignment:
| Q |
10 |
agcagcacagagtgtttggtacttcattaacagtttgatctaaattgtactctacacaagctcaccagactatgttccaccctcaactatccttgcctta |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
933878 |
agcagcacaaagtgtttggtacttcattaacagtttgatctaaattgtactctacacaagctcaccagactatgttccaccctcaactatccttgcctta |
933779 |
T |
|
| Q |
110 |
cgaatcttcaaaggctttgaaatttttatgcttctttgtttgatgcataacatcacagagccactcaccatgctctctctaaccctctttct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
933778 |
cgaatcttcaaaggctttgaaatttttatgcttctttgtttgatgcataacatcacagagccactcaccatgctctctctaaccctctttct |
933687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University