View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8717_high_2 (Length: 395)
Name: NF8717_high_2
Description: NF8717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8717_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 378
Target Start/End: Complemental strand, 30785906 - 30785517
Alignment:
| Q |
1 |
aagtttatattcatgaatcannnnnnnnctcttattcaagtttaataattttcactctactactcttcacagggaaccaatccaaaacaaaatcaccaag |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785906 |
aagtttatattcatgaatcattttttttctcttattcaagtttaataattttcactctactactcttcacagggaaccaatccaaaacaaaatcaccaag |
30785807 |
T |
 |
| Q |
101 |
catctcagaaactcacattatcattgggtgaatcagtgtctagtgcagctctagttgctcttctatctgcttctctcttctttgttgatcctgcacttgc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785806 |
catctcagaaactcgcattatcattgggtgaatcagtgtctagtgcagctctagttgctcttctatctgcttctctcttctttgttgatcctgcacttgc |
30785707 |
T |
 |
| Q |
201 |
attcaaggtatatacttaatactattactaactaactatgcagggcctacacttcaatatgaatgtttgtctgatgtccgacacatgttagtgtgttgtc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
30785706 |
attcaaggtatatacttaatactattactaactaactatgcagggcctacacttcaatatgaatgtttgtctggtgtccgacacatgtcagtgtgttgtc |
30785607 |
T |
 |
| Q |
301 |
tggtgtccgtatttttgttagtacttcgtggtgt------------gttggtgtccgtgtctgtattagtgttcgtagatagctaatcat |
378 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30785606 |
tggtgtccatatttttgttagtacttcgtggtgtgtatgtatcttggttggtgtccgtgtctgtattagtgttcgtagatagctaatcat |
30785517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University