View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8717_high_7 (Length: 240)
Name: NF8717_high_7
Description: NF8717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8717_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 16686531 - 16686305
Alignment:
| Q |
1 |
tatttaataatgtggttagttagttttgataactaaaattttgggatttggttggcaaacatcagaagcaga---tggatgtagccttaaacttcggtca |
97 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16686531 |
tattttataatgtggttagttagttttgataactaaaattttgggatttggttggcaaacatcagaagcagaagttggttgtagccttaaacttcggtca |
16686432 |
T |
 |
| Q |
98 |
cttgagtcttaagagaccaaatcgttaaagcaaaataatgtattnnnnnnngatttccttcatctctttaggtgtcttatttccgatttacatgctttta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||| ||||| ||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
16686431 |
cttgagtcttaagagaccaaatcgttaaagaaaattaatgtattaaaaaaagattttcttcatctctttaggtgtcttgtttccgatttacatactttta |
16686332 |
T |
 |
| Q |
198 |
agaaaatgattacctatgggtacatat |
224 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
16686331 |
agaaaatgattatctatgggtacatat |
16686305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University