View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8718_high_5 (Length: 240)
Name: NF8718_high_5
Description: NF8718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8718_high_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 2023253 - 2023473
Alignment:
| Q |
19 |
gtgcagccctagtgttaatggttgaatgtaaagagatttttgcattgattaactatatcaaatattcttgcattgattgttcctgtaatgaacacacaac |
118 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2023253 |
gtgcagccct-gtgttaatggttgaaagtaaagagatttttgtattgattaactatatcaaatattcttgcattgattgttcctgtaatgaacacacaac |
2023351 |
T |
|
| Q |
119 |
ctactaatcaaaccgttggttagttttagctactgctagggaaatttacatttcattagagcagaccattgattataccgaagtttgataggcgggcaag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2023352 |
ctactaatcaaaccgttggttagttttagctactgctagggaaatttacatttcattagagcagaccattgattataccaaagtttgataggtgggcaag |
2023451 |
T |
|
| Q |
219 |
ttaactaacactgtagtaggtt |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2023452 |
ttaactaacactgtagtaggtt |
2023473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University