View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8718_high_6 (Length: 228)
Name: NF8718_high_6
Description: NF8718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8718_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 54 - 157
Target Start/End: Complemental strand, 29438883 - 29438780
Alignment:
| Q |
54 |
aatgcagccatatgcaattctagaatctcctgaagactccattccacgatgaaaatcctacaagattgctccaatttcatacgccctctcttgtgcttga |
153 |
Q |
| |
|
|||||||||| ||||| |||||||||| ||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29438883 |
aatgcagccacatgcagttctagaatcgcctcaagactccatttcacagtgaaaatcctacaagattgctccaatttcatacgctctctattgtgcttga |
29438784 |
T |
|
| Q |
154 |
aggc |
157 |
Q |
| |
|
|||| |
|
|
| T |
29438783 |
aggc |
29438780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 159 - 216
Target Start/End: Complemental strand, 29436157 - 29436100
Alignment:
| Q |
159 |
acatgaacaccgttttttctcaagctcatggagaacgcaacgtcaccgtactctctct |
216 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29436157 |
acatgaacaccgttctttctcaggctcatggagaacgcaacgtcaccgtactctctct |
29436100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 29439606 - 29439552
Alignment:
| Q |
1 |
taacctaatcttcattctagttttgtttcatatagatactcaaacagacaaaaaa |
55 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
29439606 |
taacttaatcttcattctaattttgtttcatatagatacacaaacaggcaaaaaa |
29439552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University