View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8718_low_5 (Length: 258)
Name: NF8718_low_5
Description: NF8718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8718_low_5 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 108 - 258
Target Start/End: Original strand, 2023731 - 2023881
Alignment:
| Q |
108 |
gaggaaccttacaacaacatatgatctgtcacaaagtatatcaattgattcagacttatttttcataccaacttcaccctattttttcgattaaaaccaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2023731 |
gaggaaccttacaacaacatatgatctgtcacaaagtatatcaattgattcagacttatttttcataccaacttcaccctattttttcgattaaaaccaa |
2023830 |
T |
 |
| Q |
208 |
gttgatttgcaaacaaacatctcagctcctttgcaatagtaaacaccatac |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2023831 |
gttgatttgcaaacaaacatctcagctcctttgcaatagtaaacaccatac |
2023881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 40 - 111
Target Start/End: Original strand, 2023614 - 2023685
Alignment:
| Q |
40 |
atttaataggcgagacaatgttaatagaaacttcattacaataaatttagaaactttgtttatggagtgagg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2023614 |
atttaataggcgagacaatgttaatagaaacttcattacaataaatttagaaactttgtttattgagtgagg |
2023685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University