View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8719_low_2 (Length: 325)
Name: NF8719_low_2
Description: NF8719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8719_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 63 - 285
Target Start/End: Original strand, 6454587 - 6454811
Alignment:
| Q |
63 |
ggtatatgtaaaagaaag--gttaaatctttaatgtgtattaatccatttagacttggaccaatcaattataggtgagattgatggaaccaatcaatttt |
160 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454587 |
ggtatatgtaaaagaaagaggttaaatctttaatgtgtattaatccatttagacttggaccaatcaattataggtgagattgatggaaccaatcaatttt |
6454686 |
T |
|
| Q |
161 |
gggtcaagtaggacaatgacctgaaatctcatagcagctcactccccggatgtggatgaaaccgatttcttctccacattgggaggagacaccgatccag |
260 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6454687 |
gggtcaagtaggacaatgacatgaaatctcatagcagctcactccccgaatgtggatgaaaccgatttcttctccacactgggaggagacaccgatccag |
6454786 |
T |
|
| Q |
261 |
gcacctctggtccatccaaaaaccc |
285 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6454787 |
gcacctctggtccatccaaaaaccc |
6454811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 285
Target Start/End: Original strand, 6454889 - 6454932
Alignment:
| Q |
242 |
ggaggagacaccgatccaggcacctctggtccatccaaaaaccc |
285 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
6454889 |
ggaggagacaccaatccaggcacctctagtccatccaaaaaccc |
6454932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University