View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8720_high_4 (Length: 312)
Name: NF8720_high_4
Description: NF8720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8720_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 161 - 304
Target Start/End: Original strand, 39245821 - 39245964
Alignment:
| Q |
161 |
tctgcttcatttgattaattatcaccaataaggctatttgaatgacttcatttttcatcgttccaataaaccgtttgaaattaacgattgcatgttatat |
260 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39245821 |
tctgtttcatttgattaattatcaccaataaggctatttgaatgacttcatttttcatcgttccaataaaccgtttgaaattaacgattgcatgttatat |
39245920 |
T |
|
| Q |
261 |
atagaacacattaatgtagtcttagaagtatattctggagaatt |
304 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
39245921 |
atagaacacattaatatagtcttagaagtatattctggataatt |
39245964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 9 - 161
Target Start/End: Complemental strand, 41658547 - 41658395
Alignment:
| Q |
9 |
aatttctgctacgtacaacagctctgaattatggtagactgaaggctgcagataataatctaaaactgtaggtggggaggtgagggagtctttcgatgga |
108 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| ||||| || |||||||| ||||||| |||| ||| |||| | || || ||||||| ||| | |
|
|
| T |
41658547 |
aatttctgctacatacctcagctctgaattatggttgactgcagtctgcagatcttaatctagaactatagttgggatgttgtggttgtctttcaatgta |
41658448 |
T |
|
| Q |
109 |
ggtaaaatgtgattgaaatgtgatatgctatatttcgacttctgctttgatct |
161 |
Q |
| |
|
||||||| ||||||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
41658447 |
tgtaaaatatgattgatatgtgatatgatatatttctacttctgctttgatct |
41658395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University